| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.124163 |
| Chromosome: | chromosome 11 |
| Location: | 2766371 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477250 | (1 of 1) PF10187 - N-terminal domain of NEFA-interacting nuclear protein NIP30 (Nefa_Nip30_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGACGGAGCTGCTGAAGGGCGATGCC |
| Internal bar code: | TTCCAGAGGGTCCCAAAAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 251 |
| LEAP-Seq percent confirming: | 71.6763 |
| LEAP-Seq n confirming: | 1240 |
| LEAP-Seq n nonconfirming: | 490 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATGGAACTCACAACACCG |
| Suggested primer 2: | ACGACAAACCCACAGAGGTC |