| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.124183 |
| Chromosome: | chromosome 5 |
| Location: | 2632755 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236400 | NAT13 | (1 of 36) PF00583 - Acetyltransferase (GNAT) family (Acetyltransf_1); N-acetyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCGAATCGAACAGCTCTCTAAAGCCCGC |
| Internal bar code: | CTCGAAGGCGCGCAGTAGCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 886 |
| LEAP-Seq percent confirming: | 99.8647 |
| LEAP-Seq n confirming: | 2952 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGACTTGGGTCCATCAAG |
| Suggested primer 2: | TATCCAGCAGAGACGTGTGG |