Insertion junction: LMJ.RY0402.124246_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.124246
Chromosome:chromosome_8
Location:3412849
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g374700 FAP244 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):AGTCACCCGGCCGCCATACCCCGCCGTTGT
Internal bar code:CTGAATATCTCGCTGTTTGATT

Confirmation - LEAP-Seq

LEAP-Seq distance:757
LEAP-Seq percent confirming:97.1098
LEAP-Seq n confirming:168
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:GCCATGCTGCTTTCTAGTCC
Suggested primer 2:CACACGTCCATCTGGTTGTC