| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.124343 |
| Chromosome: | chromosome 15 |
| Location: | 1125839 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g639504 | (1 of 3) PF13637//PF13920 - Ankyrin repeats (many copies) (Ank_4) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTTCAATCCTTGCCCCTGCCCAGCCCCT |
| Internal bar code: | AGTCTGGAGCGTGCTGGTCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 164 |
| LEAP-Seq percent confirming: | 62.4595 |
| LEAP-Seq n confirming: | 3281 |
| LEAP-Seq n nonconfirming: | 1972 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACTTGCTGCCGTCTCTAC |
| Suggested primer 2: | AGACTAGGTGGAGCAGGGGT |