| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.124552 |
| Chromosome: | chromosome 4 |
| Location: | 1650501 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g213100 | CGLD7 | conserved, expressed esterase / lipase / thioesterase family protein; (1 of 1) 3.1.1.2 - Arylesterase / Paraoxonase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGGTTATTATTTGCAATCCACTGTGGT |
| Internal bar code: | ATTCGGGTTGGGCGAATCACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 690 |
| LEAP-Seq percent confirming: | 99.8001 |
| LEAP-Seq n confirming: | 1997 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGCTTGTCATTGCCAGA |
| Suggested primer 2: | TGAGCTTCAACGACAGGATG |