| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.124593 |
| Chromosome: | chromosome 16 |
| Location: | 6219060 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675100 | CPLD53 | Conserved in the Plant Lineage and Diatoms; (1 of 3) PTHR31319:SF10 - ZINC FINGER PROTEIN CONSTANS-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCATGAGGTTCGTGTGTGTTGATGGTGT |
| Internal bar code: | AGATGACCGCGGCCGACGGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 96.8735 |
| LEAP-Seq n confirming: | 1952 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCCATTTGAAGTTGCGGT |
| Suggested primer 2: | CAATCATAATGGGGTTTGCC |