Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.124656 |
Chromosome: | chromosome 1 |
Location: | 2833117 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g017050 | MCP1 | (1 of 22) IPR018108//IPR023395 - Mitochondrial substrate/solute carrier // Mitochondrial carrier domain; Mitochondrial substrate carrier protein | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGCAAAGGCTCAGACCCGTTGATTGAAC |
Internal bar code: | GCGCACGCGTTTCTTAGAGCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 818 |
LEAP-Seq percent confirming: | 99.7279 |
LEAP-Seq n confirming: | 2566 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCAAACTGATGTTCTTGA |
Suggested primer 2: | TTGCTGTTTTTGTGCTGAGG |