Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.124700 |
Chromosome: | chromosome 12 |
Location: | 7643411 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554700 | SEC22 | Qb-SNARE protein, Sec20-family; (1 of 1) K08517 - vesicle transport protein SEC22 (SEC22) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGAAACATGCTCCACCTGCAACCGCCAC |
Internal bar code: | CAGGCGTGTCGTTTACTAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 837 |
LEAP-Seq percent confirming: | 94.4595 |
LEAP-Seq n confirming: | 2097 |
LEAP-Seq n nonconfirming: | 123 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGTGGTTTTCACACGAAC |
Suggested primer 2: | AGTGATGCTTGGAACCCTTG |