Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.124759 |
Chromosome: | chromosome 10 |
Location: | 6027430 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g463026 | (1 of 1) IPR001202//IPR001752//IPR027417//IPR027640 - WW domain // Kinesin motor domain // P-loop containing nucleoside triphosphate hydrolase // Kinesin-like protein; Large protein with small region (p-loop?) Similar to kinesin (peptide is unique) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATCCTTGCAAACCCCCCCCTGCTGCCCC |
Internal bar code: | CCGCCGATTCGCACATCGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 261 |
LEAP-Seq percent confirming: | 99.7468 |
LEAP-Seq n confirming: | 4727 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATCTTTGCAACACCCCTC |
Suggested primer 2: | COULD_NOT_FIND_PRIMER |