| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.124797 |
| Chromosome: | chromosome 2 |
| Location: | 7813418 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g142353 | TSH1 | (1 of 1) IPR013320//IPR013806 - Concanavalin A-like lectin/glucanase domain // Kringle-like fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGTGTGTGTTTTGGGGGTTGCATGCGA |
| Internal bar code: | GTGCGCGTCGAGAAACCGAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 273 |
| LEAP-Seq percent confirming: | 99.6717 |
| LEAP-Seq n confirming: | 1518 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAACACAACCACACTCC |
| Suggested primer 2: | ACTGTGAGCATGTGCCACTC |