Insertion junction: LMJ.RY0402.124848_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.124848
Chromosome:chromosome_1
Location:1723784
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g009250 TOP2 DNA topoisomerase II sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TACGAGGCCTAAGCTGCGCGTCCTATCACT
Internal bar code:CCGCGTGTGGCGACTGGAGGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:220
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:57
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:AGGAGGAGAAGAAGCCCAAG
Suggested primer 2:ACCCTACCTACGCTCCCACT