| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.124861 |
| Chromosome: | chromosome 3 |
| Location: | 7447862 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205750 | (1 of 2) K18272 - protein XRP2 (RP2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAACCCTCGCCCCACCCTAGTCCTTGGT |
| Internal bar code: | GTCCATGGTCTGACTCCTCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 98.2204 |
| LEAP-Seq n confirming: | 1711 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATACCTGCTAGCTGAGGG |
| Suggested primer 2: | GAGGAGCAAGTGTAGCCGTC |