Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.124897 |
Chromosome: | chromosome 3 |
Location: | 6351835 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g193750 | GCST,GCST1 | Glycine cleavage system, T protein; (1 of 1) K00605 - aminomethyltransferase (gcvT, AMT) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCAACTCTGGGCGCTCGACCCTTCCTGA |
Internal bar code: | CACCCGCAGGACTGCCAAAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 963 |
LEAP-Seq percent confirming: | 99.6764 |
LEAP-Seq n confirming: | 4004 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGTGTGTGTGATGGTGTT |
Suggested primer 2: | GTGGTGACAAAGATGCCCTT |