Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.125020 |
Chromosome: | chromosome 8 |
Location: | 3603521 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g375900 | EIF2A-1,EIF2Aa,EIF2X | (1 of 1) K15026 - translation initiation factor 2A (EIF2A); Eukaryotic translation initiation factor 2 subunit 1, eIF2-alpha subunit | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTGCGCCTTCTGCTCGCCTGCGGAACA |
Internal bar code: | ACGCTGGACAGATCGTGCGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 411 |
LEAP-Seq percent confirming: | 94.9086 |
LEAP-Seq n confirming: | 1454 |
LEAP-Seq n nonconfirming: | 78 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACACACGTAAGGGGTTG |
Suggested primer 2: | ACCGTAGGTGATCTTGACGG |