Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.125057 |
Chromosome: | chromosome 12 |
Location: | 7922382 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g552650 | PAP8 | (1 of 1) PTHR23092:SF19 - NUCLEOTIDYLTRANSFERASE; Class-II RNA nucleotidyl transferase 8 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGGTTGGCGCGCCGCCGCCACGCCGCC |
Internal bar code: | ATCTTGAACTCCCGCTGGGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 84 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCTCCACGAGAGTTAGG |
Suggested primer 2: | CGAGTACTACCTTGCGCTCC |