Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.125070 |
Chromosome: | chromosome 2 |
Location: | 5219238 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g105950 | FAP174 | (1 of 1) PTHR13168//PTHR13168:SF0 - ASSOCIATE OF C-MYC AMY-1 // C-MYC-BINDING PROTEIN; Flagellar Associated Protein 174 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCTGGACGCCAGGGGTCGACAGGACCG |
Internal bar code: | TTTACAGGTTGCTTTCGATGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 970 |
LEAP-Seq percent confirming: | 99.6613 |
LEAP-Seq n confirming: | 2354 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTCGACCACAGGTCCAGTC |
Suggested primer 2: | CATACACAGGCATGGTCAGC |