| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.125114 |
| Chromosome: | chromosome 14 |
| Location: | 1521163 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618500 | (1 of 2) IPR006502//IPR011333//IPR011705 - Protein of unknown function PDDEXK-like // POZ domain // BTB/Kelch-associated | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTGGCGGAAAGCGGTGGAGCGGCGGCG |
| Internal bar code: | AGGCGCCGTGTTGTTTCCCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 99.0223 |
| LEAP-Seq n confirming: | 10027 |
| LEAP-Seq n nonconfirming: | 99 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAAACGTTGTTAGCGCGT |
| Suggested primer 2: | GCAGCACACAGCTCAGGTAG |