| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125179 |
| Chromosome: | chromosome 11 |
| Location: | 3478480 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481200 | PHX17,PFH6,P4H6 | Prolyl 4-hydroxylase 6; (1 of 5) PTHR10869:SF55 - OXOGLUTARATE/IRON-DEPENDENT OXYGENASE | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATTAAAGTTTTCCAAATTAAGTTTTTTT |
| Internal bar code: | GACGGCCCGATCCACGCCAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 913 |
| LEAP-Seq percent confirming: | 99.3732 |
| LEAP-Seq n confirming: | 3488 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCGCTACAACATGAAGA |
| Suggested primer 2: | GCGTTTGTACTCTGGCTTCC |