Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.125216 |
Chromosome: | chromosome 1 |
Location: | 5270933 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g036800 | KIN9-1,KIN9A | Kinesin motor protein; (1 of 1) PTHR24115//PTHR24115:SF194 - FAMILY NOT NAMED // KINESIN-LIKE PROTEIN KIF6 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCATGCGACACGCCCGGCCTTCTGTTA |
Internal bar code: | GCACCAATGATGCCATAACGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 715 |
LEAP-Seq percent confirming: | 90.3284 |
LEAP-Seq n confirming: | 1513 |
LEAP-Seq n nonconfirming: | 162 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCTGGTAAAAGGTGGTGC |
Suggested primer 2: | TTCAGCGCTCATATCACAGG |