| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125289 |
| Chromosome: | chromosome 3 |
| Location: | 5404664 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184850 | TPT8,TPT9 | (1 of 2) PTHR11132:SF126 - PROTEIN C29A12.6, ISOFORM B; Putative UDP-galactose transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTTAGGGAAATGGTGGTGAGCGACACGT |
| Internal bar code: | ATGCCTGAACAGATCCGCGACTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 687 |
| LEAP-Seq percent confirming: | 95.5238 |
| LEAP-Seq n confirming: | 1003 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGACAAGAGGCACAAGCA |
| Suggested primer 2: | TGGTGAACAAATGGACGCTA |