| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125328 |
| Chromosome: | chromosome 5 |
| Location: | 1377595 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g244400 | (1 of 30) PF03407 - Nucleotide-diphospho-sugar transferase (Nucleotid_trans) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCAGTCCAGTTTGGCACACATCCATGT |
| Internal bar code: | GAGTATGAAGGGCAGTGTCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 754 |
| LEAP-Seq percent confirming: | 87.9177 |
| LEAP-Seq n confirming: | 684 |
| LEAP-Seq n nonconfirming: | 94 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCTAGCAGATAGCCCAC |
| Suggested primer 2: | GGGGCTGTTGGACATACACT |