Insertion junction: LMJ.RY0402.125381_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.125381
Chromosome:chromosome_12
Location:1214583
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre12.g489500 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TCCGGGACAGCATCGGCACTACTGCCGAAG
Internal bar code:GACCCGCATCAGGAAATCGACG

Confirmation - LEAP-Seq

LEAP-Seq distance:820
LEAP-Seq percent confirming:98.4127
LEAP-Seq n confirming:1488
LEAP-Seq n nonconfirming:24
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:GAGCAGGTCTAATGCTTGGC
Suggested primer 2:AAGCGACATGGCTGAAGACT