| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.125461 |
| Chromosome: | chromosome 3 |
| Location: | 4994026 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180250 | IPS1,INO1 | (1 of 1) 5.5.1.4 - Inositol-3-phosphate synthase / Myo-inositol-1-phosphate synthase; Myo-inositol-1-phosphate synthase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGGTGCGTAGCGTGGCTGATTATAACTA |
| Internal bar code: | CTCGCGACGCGGAGGTAGTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1026 |
| LEAP-Seq percent confirming: | 99.8069 |
| LEAP-Seq n confirming: | 3618 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGTTCAGACCGGAGATA |
| Suggested primer 2: | ACCTTTAGCCCGAGTCCATT |