| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.125471 |
| Chromosome: | chromosome 14 |
| Location: | 1783589 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g619854 | ELG35 | (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase; Exostosin-like glycosyltransferase 35 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTGGGAGTCAGGACCGACTTAACAGGA |
| Internal bar code: | GCTTACGGCATTCTACAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 284 |
| LEAP-Seq percent confirming: | 99.4241 |
| LEAP-Seq n confirming: | 4316 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTGCTTGTGTGTGTGTG |
| Suggested primer 2: | TGGAAGCGCACAAACACTAC |