| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125496 |
| Chromosome: | chromosome 14 |
| Location: | 469350 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g611051 | (1 of 4) IPR001810//IPR020683 - F-box domain // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGTGCCCGTACTGCCGCTGCAGCCATT |
| Internal bar code: | CAGACATCGGCACGGTAGGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 912 |
| LEAP-Seq percent confirming: | 99.6681 |
| LEAP-Seq n confirming: | 901 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGACGACGATGGAGAAGG |
| Suggested primer 2: | TGCAGCACGAATCAAAGAAC |