| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125595 |
| Chromosome: | chromosome 2 |
| Location: | 6746249 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118400 | ZCP2 | Zn chaperone; (1 of 5) PTHR13748:SF4 - COBW DOMAIN-CONTAINING PROTEIN DDB_G0274527 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAGCCCAGGCGGCACCGCGCGAGGCCAT |
| Internal bar code: | GGGAAAGATGATGCACTGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 583 |
| LEAP-Seq percent confirming: | 17.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGTAACCTCTCATCCGC |
| Suggested primer 2: | TCACAGGCAAGCAGTCAATC |