| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.125609 |
| Chromosome: | chromosome 7 |
| Location: | 5284610 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349300 | HEL41 | (1 of 2) PTHR24031//PTHR24031:SF303 - RNA HELICASE // DEAD-BOX ATP-DEPENDENT RNA HELICASE 47, MITOCHONDRIAL; DEAD box ATP-dependent RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCGGCCTTTCCTAGCCTCGCTAACACA |
| Internal bar code: | TTGATTGGATTAATCTTTCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1062 |
| LEAP-Seq percent confirming: | 98.3051 |
| LEAP-Seq n confirming: | 174 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGCTATGGGGTTGTGGG |
| Suggested primer 2: | CGCCTAGGAGCTATCACTGG |