Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.125694 |
Chromosome: | chromosome_8 |
Location: | 968319 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre08.g361950 | FAL10 | Similar to Flagellar Associated Protein FAP72 | sense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | TCTCACTGCCGTACGGGCCTTCCCGTGCGG |
Internal bar code: | AGAACGCCGCTAGAACTCGACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 585 |
LEAP-Seq percent confirming: | 99.8842 |
LEAP-Seq n confirming: | 1725 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCACATGAGCGGAGACTT |
Suggested primer 2: | CTGCAACCGCATACTCTCAA |