| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125745 |
| Chromosome: | chromosome 17 |
| Location: | 2512891 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716251 | SUMO89A,SUM5 | Similar to Small ubiquitin-like modifier; (1 of 4) PF03171//PF11976 - 2OG-Fe(II) oxygenase superfamily (2OG-FeII_Oxy) // Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGCACAGGCAGCTGGGTACGTTACAT |
| Internal bar code: | GGGGAAGTGATTGGCCCATGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 425 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 162 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATCAACACGTATGGGCAG |
| Suggested primer 2: | CGATGTGCTGGAGCATCTAA |