| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.125761 |
| Chromosome: | chromosome 4 |
| Location: | 1293400 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214750 | VMP7,VMPL2 | (1 of 2) PTHR21136:SF86 - VESICLE-ASSOCIATED MEMBRANE PROTEIN 7; Endosomal R-SNARE protein, VAMP-like family (R.III) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGACACCTCAGCTTCCTGTCATTCCGCG |
| Internal bar code: | GGTTAACACGGGTCTAGAGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 230 |
| LEAP-Seq percent confirming: | 99.6639 |
| LEAP-Seq n confirming: | 1779 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAGTCAACAAGGCGAGGA |
| Suggested primer 2: | TGCAACAAAACAAGGTTGGA |