| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.125834 |
| Chromosome: | chromosome 4 |
| Location: | 2946707 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224700 | NRT1 | (1 of 1) K14638 - solute carrier family 15 (peptide/histidine transporter), member 3/4 (SLC15A3_4, PHT); Nitrate transporter NRT1 family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCATTCACAATTTATCAAGAAGAAGGGA |
| Internal bar code: | GGTGGCTACCGTTCAGCGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 88 |
| LEAP-Seq percent confirming: | 5.39554 |
| LEAP-Seq n confirming: | 133 |
| LEAP-Seq n nonconfirming: | 2332 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTAGTTTGGGCTGGTGA |
| Suggested primer 2: | GGATGATTGGACCCACAAAC |