Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.125864 |
Chromosome: | chromosome_11 |
Location: | 2703101 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre11.g476850 | DRC4,PF2 | Component of dynein regulatory complex | sense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CTGCTAGTTCCTTTCCAGACGACGTGCATG |
Internal bar code: | CATGGACACGCCCCATTGCCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 371 |
LEAP-Seq percent confirming: | 99.6256 |
LEAP-Seq n confirming: | 6120 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCTCACAGAGTTCGGCAT |
Suggested primer 2: | ACTTCCCACCATGGACTCTG |