| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.125998 |
| Chromosome: | chromosome 2 |
| Location: | 580518 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g077650 | (1 of 2) IPR000340//IPR000387//IPR029021 - Dual specificity phosphatase, catalytic domain // Tyrosine specific protein phosphatases domain // Protein-tyrosine phosphatase-like | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCACAACAGCCTCGGCATTCACGCAGAC |
| Internal bar code: | GGTCCCCTCCGAGGGGTCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 844 |
| LEAP-Seq percent confirming: | 99.9394 |
| LEAP-Seq n confirming: | 4949 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATACCGACCCCAGCAAGTC |
| Suggested primer 2: | TCGCACTTATGGTACAAGCG |