Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.126126 |
Chromosome: | chromosome 2 |
Location: | 2109425 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g089200 | HLM4,SET3 | (1 of 1) PTHR22884//PTHR22884:SF370 - SET DOMAIN PROTEINS // HISTONE-LYSINE N-METHYLTRANSFERASE, H3 LYSINE-9 SPECIFIC SUVH5-RELATED; Histone-lysine N-methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATTGGCTAACGAACACAACCCATCTGTG |
Internal bar code: | GGGGGAATGAAGTTGGTAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 987 |
LEAP-Seq percent confirming: | 75.7151 |
LEAP-Seq n confirming: | 1297 |
LEAP-Seq n nonconfirming: | 416 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAGTGCTCTTTTGGGACG |
Suggested primer 2: | GCCTCGCAGAGTTGTCCTAC |