Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.126142 |
Chromosome: | chromosome 17 |
Location: | 6126296 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g741500 | KIL7 | Putative kinesin-like motor protein; (1 of 1) 3.4.21.72//3.6.4.4 - IgA-specific serine endopeptidase / Immunoglobulin A1 protease // Plus-end-directed kinesin ATPase / Kinesin | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCCAGTGCAGGGCGGGCGGCCTGTTG |
Internal bar code: | CTTTCGACCGGGGTCCGACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 470 |
LEAP-Seq percent confirming: | 98.8176 |
LEAP-Seq n confirming: | 3343 |
LEAP-Seq n nonconfirming: | 40 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGGCTGACAAGCTGTT |
Suggested primer 2: | CTTGAGCTGCTTCTCCTGCT |