| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.126215 |
| Chromosome: | chromosome 7 |
| Location: | 3885739 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g339000 | CrRbcXIIb,RBCX2B | RuBisCO chaperone; (1 of 2) PTHR33791//PTHR33791:SF1 - FAMILY NOT NAMED // CHAPERONIN-LIKE RBCX PROTEIN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCTCCTCGCAGTAGGCCTTGCGCACCT |
| Internal bar code: | GATACTGCCTTAGCTGGACTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 775 |
| LEAP-Seq percent confirming: | 94.2402 |
| LEAP-Seq n confirming: | 62633 |
| LEAP-Seq n nonconfirming: | 3828 |
| LEAP-Seq n unique pos: | 119 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCTGTGGAGAAGACAGCC |
| Suggested primer 2: | GCATGTACAACCCACCACAG |