| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.126248 |
| Chromosome: | chromosome 11 |
| Location: | 2890431 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477850 | TXC1,TSN1 | (1 of 1) K15979 - staphylococcal nuclease domain-containing protein 1 (SND1); Transcriptional coactivator-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGATATTTTTTGGTGCATCATTCAGCCG |
| Internal bar code: | TGCAGCTCCGTTCAGGATGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 534 |
| LEAP-Seq percent confirming: | 99.7285 |
| LEAP-Seq n confirming: | 2571 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAGTTGGGGTTGGAGGGT |
| Suggested primer 2: | ACACGCACGTCTGAATGAAG |