| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.126313 |
| Chromosome: | scaffold 36 |
| Location: | 24006 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre36.g759747 | (1 of 26) IPR029058//IPR029059 - Alpha/Beta hydrolase fold // Alpha/beta hydrolase fold-5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAGAAGCGAAGGGTTGGGGTAAGTGGGG |
| Internal bar code: | GGATTCGCCATCAGTCGGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 143 |
| LEAP-Seq percent confirming: | 95.4074 |
| LEAP-Seq n confirming: | 1932 |
| LEAP-Seq n nonconfirming: | 93 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCTCAAGACGTAGGCAC |
| Suggested primer 2: | TTTCTCGACTTCCTCGCAAT |