Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.126448 |
Chromosome: | chromosome 9 |
Location: | 4054380 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393321 | CSR12 | (1 of 6) 2.8.2.33 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase / GalNAc4S-6ST; Carbohydrate sulfotransferase-related 12 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGAACCCCTCCCTTCCACCTCGTTGGGC |
Internal bar code: | CGAGATGCGCATCCCCGGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 51 |
LEAP-Seq percent confirming: | 5.45455 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 52 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACAGCACTGTAGCTGGCAT |
Suggested primer 2: | CCCATGAAAACCCCCTTAGT |