| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.126748 |
| Chromosome: | chromosome 3 |
| Location: | 7274524 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g207250 | GLN4 | (1 of 2) PTHR20852:SF50 - GLUTAMINE SYNTHETASE CYTOSOLIC ISOZYME 1-1-RELATED; Glutamine synthetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCACCGCGCTTGGACTGGGCATAGCC |
| Internal bar code: | GTCCGTTCCCTGGACGGTAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 687 |
| LEAP-Seq percent confirming: | 99.8763 |
| LEAP-Seq n confirming: | 2423 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATCTCAGAACCCCCAGTA |
| Suggested primer 2: | ATACAATTCGCACCCTCGTC |