Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.126887 |
Chromosome: | chromosome 12 |
Location: | 7529002 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555800 | STK2,STPK2 | Serine/threonine protein kinase; (1 of 1) PTHR24362//PTHR24362:SF286 - SERINE/THREONINE-PROTEIN KINASE NEK // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTTTGGCTGTCCGGGCCCGTGCGTATT |
Internal bar code: | TGTTCAAATACTGGTAAACCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1085 |
LEAP-Seq percent confirming: | 98.43 |
LEAP-Seq n confirming: | 815 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAAATACCGCCGCAAGTACC |
Suggested primer 2: | ACCAAATTGTTTTCCTTGCG |