Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.126945 |
Chromosome: | chromosome 16 |
Location: | 1390616 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g652150 | FBP4 | (1 of 1) K01103 - 6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCCCGTCCCCCGGCCCGCCCCCTTGCC |
Internal bar code: | GGGGGGCGTGGTGTCGGATAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 836 |
LEAP-Seq percent confirming: | 99.2826 |
LEAP-Seq n confirming: | 1384 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGCTTGTTGCACAGGAAC |
Suggested primer 2: | GACAGAAATGCTGCCCTAGC |