Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.126984 |
Chromosome: | chromosome 17 |
Location: | 6784233 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g744797 | (1 of 1) PF05623 - Protein of unknown function (DUF789) (DUF789) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAATGCATTGGCATGTCGGCACACGCAC |
Internal bar code: | GTTAGGATAGATGTCGCAAGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 674 |
LEAP-Seq percent confirming: | 96.3079 |
LEAP-Seq n confirming: | 5843 |
LEAP-Seq n nonconfirming: | 224 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACCATTCTCTGGAAACGC |
Suggested primer 2: | ATCCCCTTACGCACACTCAC |