Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.126988 |
Chromosome: | chromosome 3 |
Location: | 3408426 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g166900 | CYP767A1,CYP15 | (1 of 1) 1.14.13.98 - Cholesterol 24-hydroxylase / Cytochrome P450 46A1; Cytochrome P450, CYP4 superfamily | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACCCGCGCCACACACGCCACACGTGCG |
Internal bar code: | CACGTAGCGTACTTTGCGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 677 |
LEAP-Seq percent confirming: | 98.6175 |
LEAP-Seq n confirming: | 5564 |
LEAP-Seq n nonconfirming: | 78 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACACTTCTCAACCCCACT |
Suggested primer 2: | ACCAACAATCCTCAGCCAAC |