Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.127082 |
Chromosome: | chromosome 17 |
Location: | 2183051 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g713051 | (1 of 62) PF00226 - DnaJ domain (DnaJ) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCTCCAAACAGATCGCCAACGTCCATC |
Internal bar code: | TTGGAGACACCAAACGTCAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 315 |
LEAP-Seq percent confirming: | 74.0899 |
LEAP-Seq n confirming: | 1038 |
LEAP-Seq n nonconfirming: | 363 |
LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAATAGACCCACCGCTTG |
Suggested primer 2: | CACAGGATGACAGCGAAGAA |