| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.127084 |
| Chromosome: | chromosome 11 |
| Location: | 3137072 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479250 | RANGAP1 | RAN GTPase-activating protein 1; (1 of 1) K14319 - Ran GTPase-activating protein 1 (RANGAP1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTTGCCAGCGTCCTCCTCTTCCTCCTC |
| Internal bar code: | TGAGTTACCACCAACGTGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 834 |
| LEAP-Seq percent confirming: | 93.5573 |
| LEAP-Seq n confirming: | 2367 |
| LEAP-Seq n nonconfirming: | 163 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCACCACCCTCTGCTCTT |
| Suggested primer 2: | CAAATGTTGCAGCACTCCAC |