| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.127165 |
| Chromosome: | chromosome 8 |
| Location: | 4534453 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g382650 | UBQ4 | (1 of 2) K09313 - homeobox protein cut-like (CUTL); Bi-ubiquitin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGACTCGGAGCGCAATGGCCAGGGG |
| Internal bar code: | TAGTGACGAAACGGCTCGCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 182 |
| LEAP-Seq percent confirming: | 99.807 |
| LEAP-Seq n confirming: | 517 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTTACTCCAGTAGCGACC |
| Suggested primer 2: | TGACGAGCACTATCACTCCG |