| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.127236 |
| Chromosome: | chromosome 9 |
| Location: | 7059491 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g411450 | DAP1,DNAAF2,Ktu,MOT45,PF13,PRR1 | (1 of 3) PF08190 - pre-RNA processing PIH1/Nop17 (PIH1); Dynein Assembly factor PIH domain 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGACGCAACAGAGCTTCCTTGTAGTTG |
| Internal bar code: | GGTTCAGTCGGTTGTATTGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 387 |
| LEAP-Seq percent confirming: | 98.3106 |
| LEAP-Seq n confirming: | 1804 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACACCTTCTGACCCACAGG |
| Suggested primer 2: | CAAGCATGTCACGGCTAGAA |