| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.127290 |
| Chromosome: | chromosome 4 |
| Location: | 2110365 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g219400 | DNJ30 | BTB/POZ domain protein; (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCACACAACCGCCCCGCCCGGTCGCCC |
| Internal bar code: | GGATGCCCGGGGCAACCGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 99.8772 |
| LEAP-Seq n confirming: | 1627 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCATACAACCATGCAGTT |
| Suggested primer 2: | TATGAATGCGACGGCATAAA |