| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.127348 |
| Chromosome: | chromosome 17 |
| Location: | 3956709 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728650 | FAP196 | (1 of 2) PTHR13720//PTHR13720:SF14 - WD-40 REPEAT PROTEIN // WD REPEAT-CONTAINING PROTEIN 16; Flagellar Associated Protein 196 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGACTCCCCCCCGCTGGTGCTGTCCTG |
| Internal bar code: | CATCGTGCAAGAGTATTTCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 568 |
| LEAP-Seq percent confirming: | 98.9335 |
| LEAP-Seq n confirming: | 8163 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | GTTTGGCTTGGTTTGGTGAT |